trueguide synthetic sgrna sdc3  (Thermo Fisher)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3, but not the other syndecans, is upregulated in response to IFNγ in human macrophages. ( a ) SDC1 , SDC2 , SDC3 and SDC4 mRNA levels in control and IFNγ-treated THP-1 macrophages, as assessed by RT-qPCR ( n = 4–6). ( b ) Representative flow histograms (upper panel) and pooled data (lower panel) showing the protein expression of SDC1, SDC2, SDC3 and SDC4 in control and IFNγ-treated THP-1 macrophages ( n = 4–6). ( c ) Representative confocal images ( n = 3) of control, IFNγ- or IL-4/IL-13-treated THP-1 macrophages immunostained for DAPI and SDC3 (scale bar 5 μm). ( d ) SDC3 mRNA levels in control, IFNγ- and IL-4/IL-13-treated THP-1 macrophages, as assessed by RT-qPCR ( n = 3). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by ns: not significant, ** p < 0.01, *** p < 0.001 and **** p < 0.0001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Control, Quantitative RT-PCR, Expressing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3 deficient macrophages exhibit aberrant proliferation, adhesion and expression of cell surface markers. ( a ) Representative immunoblots ( n = 3) of WT or SDC3 KO THP-1 macrophages stimulated with either 100 ng/ml of IFNγ or 20 ng/ml of IL-4/IL-13 cocktail. ( b ) SDC3 mRNA levels in control, IFNγ- and IL-4/IL-13-treated WT or SDC3 KO THP-1 macrophages, as assessed by RT-qPCR ( n = 3) ( c ) Representative brightfield images of WT or SDC3 KO THP-1 macrophages (scale bar 20 μm, n = 3). ( d ) Proliferation of WT or SDC3 KO THP-1 cells up to 5 days ( n = 3). ( e ) Adhesion activity of WT or SDC3 KO THP-1 macrophages, as quantified by Crystal Violet ( n = 2–3). ( f ) Flow cytometry data showing the expression of CD40, CD86 and CD163 in WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ ( n = 7). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by ns: not significant, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Expressing, Western Blot, Control, Quantitative RT-PCR, Activity Assay, Flow Cytometry

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3 -defective macrophages show distinctive gene expression patterns. ( a ) Heatmap of differentially expressed genes in IFNγ-treated THP-1 WT and SDC3 KO macrophages ( n = 3, purple represents upregulation and green represents downregulation). ( b ) Differentially expressed pathways in IFNγ-treated THP-1 WT and SDC3 KO macrophages where blue represents pathways upregulated in SDC3 KO macrophages, and orange represents downregulated pathways in SDC3 KO macrophages ( n = 3). ( c ) TNF , IL10 , iNOS , PD-L1 , CD86 , and VEGFA mRNA levels in IFNγ-treated THP-1 WT and SDC3 KO macrophages, as assessed by RT-qPCR ( n = 3). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Gene Expression, Quantitative RT-PCR

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3 promotes macrophage phagocytic capacity and inhibits tumour-spheroid formation. ( a ) Left: Representative images of IFNγ-stimulated WT or SDC3 KO THP-1 macrophages co-cultured with MDA-MB-231-GFP breast cancer cells. Images were taken with a Leica SP8 Lightning confocal microscope (scale bar 20.5 μm, n = 3). Right: Quantification of phagocytosis rate by flow cytometry normalized to WT, using the inhibitor of actin polymerization Cytochalasin D as control ( n = 3). ( b ) Left: Representative images of IFNγ-treated WT or SDC3 KO THP-1 macrophages forming spheroids with MDA-MB-231-GFP cells. Images were taken using Nikon Eclipse TD 100 microscope at the indicated times (scale bar 100 μm, white colour represents GFP + tumour cells). Right: Proliferation of MDA-MB-231-GFP + tumour cells in each condition normalized to MDA-MB-231 condition, calculated after acquiring single cell suspensions of spheroids by flow cytometry ( n = 3). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by * p < 0.05, ** p < 0.01 and **** p < 0.0001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Cell Culture, Microscopy, Flow Cytometry, Control

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3 plays a role in macrophage pro-inflammatory functions. ( a ) Left: Representative confocal microscopy images of WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ and incubated with pHrodo™ Green S. aureus bioparticles. Images were taken using a Leica SP8 Lightning confocal microscope (scale bar 10 μm). Right: Flow cytometry quantification of S. aureus phagocytosis normalized to WT, using the inhibitor of actin polymerization Cytochalasin D as control ( n = 3). ( b ) Cytokine quantification in cell supernatants from WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ, using the LEGENDplex™ HU Essential Immune Response Panel ( n = 5). ( c ) Quantification of T cell proliferation index using CellTrace CFSE staining ( n = 5) in CD8 + T cells co-cultured with IFNγ-treated WT or SDC3 KO THP-1 macrophages. ( d ) Quantification of T cell activation markers PD-1 and CD95 by flow cytometry in CD8 + T cells co-cultured with IFNγ-treated WT or SDC3 KO THP-1 macrophages ( n = 5). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by ns: not significant, * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Confocal Microscopy, Incubation, Microscopy, Flow Cytometry, Control, Staining, Cell Culture, Activation Assay

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: SDC3 deficient macrophages regulate EC migration and tube formation. ( a ) HUVEC migration over the indicated times in response to conditioned media (CM) from WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ. Serum-free media (SFM) was used as negative control ( n = 4). ( b ) Quantification of HUVEC migration (Cell Index) shown in (a) at 48 h ( n = 4). ( c ) Representative images of Matrigel-grown HUVECs treated with supernatants from WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ. Tube formation was imaged using an Olympus IX-83 inverted microscope (scale bar 1 mm, n = 4). ( d ) Quantification of total tube number shown in (c) at 24 h, relative to WT untreated control ( n = 4). ( e ) VEGFA quantification by ELISA in the supernatants of WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ ( n = 4). ( f ) Angiogenic factor quantification in cell supernatants from WT or SDC3 KO THP-1 macrophages stimulated with 100 ng/ml of IFNγ, using the LEGENDplex™ HU Angiogenesis Panel 1 ( n = 4). Means ± SEM. Statistically significant difference from controls or between indicated groups is shown by ns: not significant, * p < 0.05 and *** p < 0.001

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Migration, Negative Control, Inverted Microscopy, Control, Enzyme-linked Immunosorbent Assay

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Syndecan-3 positively regulates the pro-inflammatory function of macrophages

doi: 10.1007/s00018-025-05649-1

Figure Lengend Snippet: Macrophage-derived SDC3 plays a role in the regulation of the TME. The plethora of cells present in the TME interact to promote or inhibit tumour progression and growth. SDC3 is expressed by macrophages in response to the pro-inflammatory cytokine IFNγ and regulates many aspects of the TME. Firstly, SDC3 in macrophages reduces tumour proliferation and is necessary for macrophage-mediated tumour-cell phagocytosis. The expression of SDC3 promotes a pro-inflammatory phenotype in macrophages that results in the secretion of cytokines such as MCP-1 and IL-10, while reducing the release of IL-8. Additionally, SDC3 is necessary for the acquisition of an effector phenotype by T cells, shown by an increased expression of PD-1 and CD95 on T cells. Finally, macrophage-derived SDC3 plays a role in the inhibition of endothelial cell migration and proliferation through a reduction in the secretion of angiogenic factors such as VEGFA, PECAM-1 and IL-8

Article Snippet: Deletion of SDC3 in THP-1 cells was performed using the following TrueGuide Synthetic gRNAs (sgRNAs) from ThermoFisher Scientific: CRISPR923443_SGM TrueGuide Synthetic sgRNA SDC3 (target DNA sequence: AACTGGATGACCTCTACTCG Cat. #: A35511) targeting the exon 2 of human SDC3 gene.

Techniques: Derivative Assay, Expressing, Inhibition, Migration

Journal: Cell chemical biology

Article Title: Hydroxyproline metabolism enhances IFN-γ-induced PD-L1 expression and inhibits autophagic flux

doi: 10.1016/j.chembiol.2023.06.016

Figure Lengend Snippet: All experiments performed with THP-1 cells treated for 72 h. IFN-γ: 50 ng/mL, Hyp: 40 mM. One-way ANOVA was used. Bars represent mean ± SEM. (A) Confocal microscopy analysis of THP-1 cells expressing a mCherry-EGFP-LC3B fusion protein. Baf-A1 (bafilomycin A1, 50 nM) was applied for 4 h. Representative images are shown. Scale bar = 10 μm. (B) Analysis of the overlap of mCherry signal and EGFP signal, from the experiment depicted in A. Each data point indicates an independent field. Mander’s Overlap coefficient (MOC) is plotted. (C) Western blot analysis of LC3B. Baf-A1 (500 nM) was added for the last 2 h of treatment. LC3-I (soluble form) and LC3-II (phosphatidylethanolamine conjugated form) are indicated. LC3-II intensity is quantified, normalized to the β-actin loading control, and relative to the +IFN-γ -Hyp +Baf-A1 sample. (D) Western blot analysis of ULK1 phosphorylated at S757. p-ULK1 (S757) normalized to total ULK1 and β-actin is quantified. Torin-1 (1 μM) was used as an assay control. (E) Western blot analysis of p62 expression in cells treated with IFN-γ and/or Hyp. p62 normalized to β-actin is quantified. (F) Flow cytometry analysis of autophagic flux in either non-targeting control or ULK1 KO THP-1 cells. Autophagic flux calculated as the ratio of mCherry fluorescence to EGFP fluorescence. Normalized to the vehicle treated, non-targeting control. (G) Flow cytometry analysis of PD-L1 expression on the same cells as F. (H) Western blot analysis of ULK1 and PD-L1 in ULK1 KO or non-targeting control cells. PD-L1 densitometry (all bands combined) normalized to the β-actin loading control, relative to the IFN-γ + vehicle, non-targeting control.

Article Snippet: TrueGuide Synthetic sgRNA, human ULK1, Assay ID: CRISPR887528_SGM, Target DNA Sequence: GGAGAACTCGAACTTGC CCA , Thermo Fisher Scientific , Cat#A35533.

Techniques: Confocal Microscopy, Expressing, Western Blot, Control, Flow Cytometry, Fluorescence

Journal: Cell chemical biology

Article Title: Hydroxyproline metabolism enhances IFN-γ-induced PD-L1 expression and inhibits autophagic flux

doi: 10.1016/j.chembiol.2023.06.016

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: TrueGuide Synthetic sgRNA, human ULK1, Assay ID: CRISPR887528_SGM, Target DNA Sequence: GGAGAACTCGAACTTGC CCA , Thermo Fisher Scientific , Cat#A35533.

Techniques: Recombinant, Modification, Synthesized, Transfection, Sequencing, Negative Control, Software, Mass Spectrometry, Targeted Proteomics

Journal: Cell chemical biology

Article Title: Hydroxyproline metabolism enhances IFN-γ-induced PD-L1 expression and inhibits autophagic flux

doi: 10.1016/j.chembiol.2023.06.016

Figure Lengend Snippet: All experiments performed with THP-1 cells treated for 72 h. IFN-γ: 50 ng/mL, Hyp: 40 mM. One-way ANOVA was used. Bars represent mean ± SEM. (A) Confocal microscopy analysis of THP-1 cells expressing a mCherry-EGFP-LC3B fusion protein. Baf-A1 (bafilomycin A1, 50 nM) was applied for 4 h. Representative images are shown. Scale bar = 10 μm. (B) Analysis of the overlap of mCherry signal and EGFP signal, from the experiment depicted in A. Each data point indicates an independent field. Mander’s Overlap coefficient (MOC) is plotted. (C) Western blot analysis of LC3B. Baf-A1 (500 nM) was added for the last 2 h of treatment. LC3-I (soluble form) and LC3-II (phosphatidylethanolamine conjugated form) are indicated. LC3-II intensity is quantified, normalized to the β-actin loading control, and relative to the +IFN-γ -Hyp +Baf-A1 sample. (D) Western blot analysis of ULK1 phosphorylated at S757. p-ULK1 (S757) normalized to total ULK1 and β-actin is quantified. Torin-1 (1 μM) was used as an assay control. (E) Western blot analysis of p62 expression in cells treated with IFN-γ and/or Hyp. p62 normalized to β-actin is quantified. (F) Flow cytometry analysis of autophagic flux in either non-targeting control or ULK1 KO THP-1 cells. Autophagic flux calculated as the ratio of mCherry fluorescence to EGFP fluorescence. Normalized to the vehicle treated, non-targeting control. (G) Flow cytometry analysis of PD-L1 expression on the same cells as F. (H) Western blot analysis of ULK1 and PD-L1 in ULK1 KO or non-targeting control cells. PD-L1 densitometry (all bands combined) normalized to the β-actin loading control, relative to the IFN-γ + vehicle, non-targeting control.

Article Snippet: 150 , 151 TrueGuide Synthetic sgRNA from Thermo Fisher targeting human ULK1 were used: CRISPR887528_SGM, CRISPR887531_SGM, and CRISPR 887533_SGM.

Techniques: Confocal Microscopy, Expressing, Western Blot, Control, Flow Cytometry, Fluorescence

Journal: Cell chemical biology

Article Title: Hydroxyproline metabolism enhances IFN-γ-induced PD-L1 expression and inhibits autophagic flux

doi: 10.1016/j.chembiol.2023.06.016

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: 150 , 151 TrueGuide Synthetic sgRNA from Thermo Fisher targeting human ULK1 were used: CRISPR887528_SGM, CRISPR887531_SGM, and CRISPR 887533_SGM.

Techniques: Recombinant, Modification, Synthesized, Transfection, Sequencing, Negative Control, Software, Mass Spectrometry